Outrageously Funny Search Suggestion Engine :: Apatetorides

🔎


What is the definition of Apatetorides? 🙋

👉 Apatetorides are a group of proteins that play an essential role in the regulation of gene expression and cell proliferation, often involved in various cellular processes such as cell division, differentiation, and cancer development. They are primarily encoded by the human ATGATACATATACTAGATTTAGTATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT


Apatetorides

https://goldloadingpage.com/word-dictionary/Apatetorides


Stained Glass Jesus Art